RNA Probe Synthesis from a cDNA Derived Template

 
Eve Mellgren        E.mail: emmellgr@artsci.wustl.edu

1)  Isolate first strand cDNA.  [for our purposes cDNA was made by first
isolating RNA with Trizol reagent (Life Tech., Cat. No. 15596) then using
this in a first strand cDNA synthesis protocol with Superscript II Rnase H
Reverse Transcriptase (Life Tech., Cat. No. 18064-022)]

2)  Design primers from coding sequence of your gene of interest.  Include
the T7 RNA polymerase recognition sequence on the  5' end of your reverse
primer. (any RNA polymerase promoter can be used (T3, Sp6), but we find T7
to be the most reliable)

T7 RNA polymerase promoter: 5' TAATACGACTCACTATAGGG 3'

Reverse primer example:

5' TAATACGACTCACTATAGGGTGGGGGAACTACAAGTTTGG 3'

   Bold = reverse primer for your gene

3)  Set up PCR reaction to amplify template DNA

  -2ul cDNA (the Superscript II protocol recommends using 10%
      of your first strand reaction for PCR)
  -0.5ul f primer
  -0.5ul r primer
  -0.2ul Taq
  -36ul PCR mix    (2.05mM MgCl2, 13.6mM Tris base,
      68.2mMKCl, 0.0014% gelatin, 1.8mg/ml BSA, 25uM
      each dNTP, pH 8.65)
  -10.8ul dH20
 

PCR program
  Temp. (0C)      Time (min.)
     92       0:30
     94       0:10
     AN     0:45
     72       1:15
                X 30 cycles
     72       4:00
      4        hold

  AN = annealing temp. for your primers

4)  Purify PCR product using Qiagen PCR purification kit (Cat. No. 28104).
Elute DNA  in 30 ul of DEPC treated water.  Check 1ul on 1% agarose
gel to quantitate and  check for appropriately sized product.

5)  Use DNA template in RNA probe synthesis reaction - wear gloves and use
RNAse  free reagents

  9ul purified DNA template ( typically the PCR yields about
     18ug of DNA resuspended in 30ul so 9ul of this is just
     over 5ug template)
  4ul 5X reaction buffer
  2ul DTT
  2ul T7 RNA polymerase
  2ul Digoxygenin labeling mix
  1ul RNAse inhibitor

 -incubate at 370C for 2 hours, add 1ul more T7 RNA polymerase
  incubate for 1 more hour - add 2 ul RNAse free DNAse and incubate
  at 370C for 15 minutes.

6) Precipitate RNA probe by adding:

  2ul 5M LiCl
  2ul 200mM EDTA
  75ul EtOH

 -store at -800C for at least 30 min. (overnight is ok too).
 -centrifuge at 40C for 30 min. add 70% EtOH to wash once,
  centrifuge 5 min. to ppt, let sit 1 min to dry, resuspend probe
  in 50 ul DEPC treated H2O with 1 ul RNase inhibitor.
  Store at -800C
 

Last Updated:
February 28, 2000