WUZGR - Zebrafish Gene Info Page
Home : Zebrafish Gene Info



Gene GILG:Nearest MarkerPrimers
10086673:Z11702GATTTGCCAATGACTCCACCGTC:TAACAGATGGCAATCTGAAAG
10089089:Z10789CCATTTGTTTACCACGCTTC:GGTTTTACACTGGCTCGTC
106571523:nadl12GAGACCAAACGTGGATTC:CTGGTAGGTTTTCTTGGC
109862615:hsp47GAAACCCATTTGACCCCAG:TTTATCACCCTTAGGGCGAAC
11434407:Z20715CTTTGTTTCTGATGGGTATGG:ATGACTTAGGACATAGAAGGG
11711417:fb08b12TACGCCGTAATAGAGGACCAG:CGTTCCCATTTGATACAGGAG
12359719:dermo1CACACTGCCCTGAAAAAAGAC:ATTTGCTCCCCTGCTTCTCC
12793918:her2TGTCTGAGTCTGAGAGCAC:CAGCAGAAACGTACTGAGG
12793938:her2CAGAATTATTGGCGACCTTG:ACACAGTGCATGAGAAGC
127939523:fa08e04GCCAAACAACACACTCCAG:GCAATTCTTCTCCCATGAAAG
12793976:HER-6CTGTTATTCCAGTCTACGC:TTTTTTTCCTCGGAGTCTACC
131463416:Z3104GGTGCGTTCAATGTATCAG:TTCGTGGCATATCCCAAG
139951614:msxeCAGCTTTCGGGATTTCGTTT:TTTTACAGCTCAGGCATCCC
151951620:Z6804GGGACTTGGGTTATTTATCGG:TCATTAATTGGGAGGGATCGG
16170399:Z6268CTTACCCTTTTCATTCCCAC:GCGAATATGGATGAGAAAGC
16205151:Z1463ACAACCTCATCACAGCTCT:CCACGGCAAACATCTTTAAC
162051719:dlx4CGACAATGGAACTATCTGAC:AGAAAACATCTACGAAGGAGG
162051912:Z1473GAAAAAATCAGAGCCAGAGAGAC:TGTAATATGGGAGTTCGGGAG
16205213:fb51h09CGTCCCATCTACTGATTCC:GCCACAAAAACCTGCAAGC
166123120:Z7803CTGTCTCATTCTGTCTCTGTC:TTTGTCCTCTCGCTAACCACC
16836343:Z10964CAAGGTCATCCGTGACTTC:CATTCAGACTGGCGATAGC
17527095:Z22309AGGGTGAAGTGTTTTGGGGCATAA:GCGCTCTGGCACACCTCTTCTAAC
176276611:fb48h07GAATCCAGATTTGGTTCCAG:TCTACTCTCAGTGTTCTTCTC
177021918:Z5231GCTCTTGCAGCATTTAATGG:CTTGAAGTTGGTCTTTAGGG
180565923:Z4421GGATGTTGAGGATCCATCCTGTGAT:CTGCAGTACIATIGTCCTGGCCA
18344308:al1CAGAGGGTCACATCAAAGAG:AGACGAAGGACGAAAGAAGG
209858720:Z6804TGTTGTGACGTACAGTCCCG:AAGGGCTCTGGGAAGATGTAG
21047177:Z21519GATAAGTACATTGTGACGGG:CCATCCATAGGTCTTTACTTC
214914520:Z22041CCATCTAAACTCCACCAACC:ATGACCTTCTCATACTCGTCC
214914720:bmp2aGCTCAGCCCTATCTCACTGC:TTTCTTCCTCCAAAATAGCTCG
21498117:gscGTTCTGGAATGGGCTGTAG:TTGTTCCTGTTTTCAGGCGAC
2150155:fb33e09TGCTGTCGRCATTTACTGGAAC:TGCTTTATCACGKACAGCTGA
219879224:ek1TCCAAGGACAAGAACCGAC:CAAGGACATCTCGCTGAAC
21987942:zek3AGCAACAACTGACTGGGAC:GAAACACAGGCTGCGATAC
220934021:Z4492CATCAGTATCTGGACATCAAC:TAACTGGCAAAGACGGTGG
22456073:fb77c07TGGAGAAAGCACTGAGGGAC:TCTGCCGTTGAAGAAATCCTG
24400545:fa05d11ATGTATGAGACCATCGCC:ATCTTCTCTCCTTCTATCACC
244005616:Z11376GTGAGAGGTTGATAAAGTGG:ACTGAGAAAGTAAACGTGGTG
246295221:fd02e12CTACATGGTCAATTATGACGG:TGAAAAGCTGAAACTTCTCGG
252216825:fibl1cCGCACATTGTCATTCTTTAGG:TGAAGAAGCAGCCAATCAAAC
252217025:fibl1cATTCGACCTGTTCGTCACGC:ATTTCCTTCCCAGAATCCCCC
252922020:Z6804CCAGATTAACCTCATGCCC:GATTACTGCGATTACAGCACC
252922418:Z5479GCACTATGTCCTGTGGTTG:ATCTTCCCCCTTCCTTTCC
252922625:Z8224CCAACACTTTTCAGTACCAAC:TCCTTCCTCACCCAAACAC
25707918:fd19h05TACGAGGACGGAACATTCAAC:ACCGAGGCGAGTCTTTACTG
25763342:CAH-ZGCCACTTGCCTTCTGATTATG:GACAAACGCAGACAGTTTTAG
25788195:Z22208CATGGTCGATTATGACATGG:TAGTGCTGAAGAGTAGGG
266074613:msxcCATCCGTCTATCCTCTCTC:GTGTTGTCAGTGCATTCTCTC
266180619:Z13773AAGTCGCCCGTCTACTGAAC:TCATCTCTCATCCTCACCTAC
273157715:Z6024CACAAACACACACAGAAGAG:CAAACAACAGTCAAAGGCAC
276498716:Z10036GTATGGGCAGAATGAGAG:GCAATAGGTGTGAAATCCAG
291136910:Z6410CAGATAATGCAGAGATAGCC:GAGCGTTACAGTACATCAAG
292138720:Z13214TAACACTTTGCACTCCTACAG:TGGATTTGAGATCATGCGAAC
29353641:C3AAGTCATCGCCACTCATTATC:ATGTACTGCTCGGTCTGTC
293540221:fc08a04GTCAACCCTACACCAATC:GTTTCCTCATCAAAGCCC
29357035:fd05a10AGAGGCATTGTAGAGCAG:CAAACGGAGAGCATTAAGG
298234018:Z10729CAGGACATCTTCAACACGG:GTCGAGGAACTATCACTGG
298234225:mariposaGTGTTTGAATCGCACAAGG:GCAGACTGAGACAAGTTTAG
29823467:Z9273CAGATGTTGCAGCCTTTC:GAAGGAGCATTGTTCACAG
29823486:Z13538CGTCCCGTCAAATATCATC:GTCTTTACATGGCTACATTGG
298235017:fc16e08CTTGTAGTTCCCCCATTGTG:AAAACGAGGTAAGTAGACCCC
29823548:Z22483ACCATACACCACACAACC:CATCGTTTCCTGCGTTATAC
300590424:ek1TGAAGACTGGCTGGACTTG:AATTCACTGCTGCTGACATAC
30442091:fc18f06TCAAACGAACGACCAACC:ACATCCCTTATTCACATACCC
31700912:Z21490CATTGTAGCACACCGTAG:CGCAAATTCACAAAACCAGAG
317124017:Z21435CCTATCCAGTTTTTCCTCC:GTTCACTTACAGTCTGATCC
321200820:Z22041ACCCTGTTCTCTTTGACCC:ATCATGCTCGACTCGATCC
328671621:fb06g05AAGCCCCACCCCCTAATC:ACCAGTCCAAAATTTGGCATC
337458115:Z8336GTGGTTCAAGAATCGACGTG:AGGCTAATCTGATTCCTGATG
337859514:Z22128TGCTCTCACTCGCTTTTGG:TGCATTGCTATTGCACAGGTC
34208459:Z6663CAATACTGGAGAGGACACGG:TTACAGGTGGAAGCAGCAGG
355107213:fa28g06TCATCAGCATCTTCACAGAGG:CACAGAAAGCAGCAAAGGCAC
35999438:fgdACAGCAAAAGCCAATAGGAAG:ACCGATCATCAACAGAGAGAG
361783822:Z13794ATTcAgcAgcccTATc:gcAgggcTAAAgTTggggT
366158213:Z21657AGTCAGGACCGTTATGAG:GTTTCATGTTGGACAGCAG
36766593:Z8681CCGCTTTCCAGAAATTCATC:GCTTCAACTCAGAATAGCAC
370309720:snap251ATGCACATATCACCCGG:AGTGCTCGTCGTATTAG
370309917:fa27g06GACATGGCTGACTCCAACAAAA:TGGCAGGCTAAGATAAG
409917314:fc08g11TGTGCCAGTTGAGATGCTTC:TCCATCTTGTGTGTGACAATCA
40991751:Z7573TCTGGATGTCCGTCATTTCA:TGTGAAACACAGGCAGAAGC
44115815:fa96g06TTTGCGGGAGGTTTGGAAG:CACCACGGACATGAAAAGAAG
4601269:dlx2TTGCAGCAGGGTGAATCAG:TGGGACACATACAAGACGG
46012819:dlx4CTCTTCGTGGTATTCCTCT:CTTCTAGGACTGCCATATC
4750493:Z1140AGGACAGAAGCGTCTTTGCC:ATCCCAGAGAGAACAAGTCAG
4991298:fb79b06TCTTTGACGGCATCGGGAAC:TACTCTCTGTACGCCCACATC
5163569:Z20327CTCCTGCTGCATACCCACTA:TACATTGCATAGTTCGTGCG
53145520:Z6804ACAGTTCTCCTGTCACCACC:TTTGCAGAGGGGACGTAAAAG
5402374:zash-aAGCCTGCCGTAAATTGCTC:ATTACACTCCTCTAAAAGCCC
5402397:zash-bAATGAGCCAGTGTGTTCC:CGTTAGTGTATCCCCTTG
59324929:desmGCAGTGACCCATTACCGCAT:CAGATATGACCCAACCACAC
601920018:fli1GGGGAATTCTTACCCAAGACAGACATGACT: CGCGGATCCCCCGCCCACCATTTTATTGCA
6085442:elrAAAATGAAGGAGAGAGGGGG:CGAGACTGAGAAAACGTGAAC
6085463:Z10964TGTTGTGTAGAGAGAGAAGAA:AGGCTTGAAGGAAGGCCTAG
6085463:elrCTTCAAGACCAGCAAGCAG:GTATGTTAGAGAGAGACTCAG
6085488:Z11001CACTTGTGTAGCTCCTTACAG:TTTGTGGGATTGTTGGTTGGG
62320920:ncadTAAGCTCCCTTCACTCGTC:GTAAATTTTCCTCCTCCTCC
625132:En-1CCAGAATAATCGTTACCTGAC:TTGTTCCCCGTTGCTTTTTT
625147:fb08b12AGTTCCAGACCAACCGCTAC:TGTATTGCCAGACCGTTCTTG
625637:Z13892AGTTCCAGACCAACCGCTAC:TGTATTGCCAGACCGTTCTTG
6331341:fb26d12ACCACTGGCGTCCCGTCG:CCGCCGCAGAGCTGAAGT
726575:coe2TCAAGGGGGAATCAGAGAC:CACAATCAGAGGCAATCGG
84771121:Z6089CGCATCTGATGGTCAGAAGTG:AACCGAGCCTCTGTGTCTTG
8612069:fb36h02CTACTGCGATATGATGAACTG:ACAAATCCACTTTCCCTTCAC
91405019:csk2bGATTGACGCCAACCTGCTG:CTACTCTGACTCTTCTCTACC
96891414:Z20953GCGGTCAACCTGCATAACAA:CTGCATCCAGCATGTCTGAA
98580551:Z5024CACTGTGCTGGCTTCCACTG:ATTCTTAAAGCGCTTGCTAACCAT
dermo19:dermo1TCGCCATGATGATAGTACAGG:CATTGGATGGAAATCGAAAAA
hbae312:hbae3GCTTAACTAGGTTTATGTTA:AGTCTTATTTCTTCTAAATT
ndr35:fc01b03GTATAGTAGTGTGTATGAGCATCTGG:AGCTGACCCGCTCMGGTT
tfa2:tfaCGATATGATTGAGAGGACCTACAA:TCATTTCATCCCCTTTTGTGATA

There are 110 genes listed above.



other zebrafish genome sites:
ZFin Database at University of Oregon
Fishman-MGH
Halpern-Carnegie Institute of Washington
Zon-Children's Hospital, Boston
Talbot

Steve Johnson Lab
Department of Genetics
WU-Genome Sequencing Center
Washington University in St. Louis
Senior BioInformatics Coordinators: Dan Fischer
Rick Waterman